foto perfil

Desplazamiento de Marco: Tipos, ejemplos y efectos de mutaciones

Publicado el 14 abril, 2024

Revisión de tipos de mutaciones

Las mutaciones son cualquier cambio hereditario en una secuencia de ADN. Hay dos tipos amplios de mutaciones: mutaciones por sustitución de nucleótidos y mutaciones por cambio de marco, cada una de las cuales tiene sus propias subcategorías. En general, las categorías de mutaciones son:

  • Sustituciones de nucleótidos: un nucleótido se cambia por otro, por ejemplo, “A” se cambia por “G”; También conocidas como mutaciones puntuales.
    • Mutaciones silenciosas: sin efecto sobre la secuencia de aminoácidos
      • por ejemplo, CAG (Gln) → CAA (Gln)
    • Mutaciones sin sentido: un aminoácido se cambia a otro
      • por ejemplo, CAG (Gln) → CAT (Su)
    • Mutaciones sin sentido: se cambia un aminoácido por un codón de parada; la proteína termina prematuramente
      • por ejemplo, CAG (Gln) → TAG (Detener)
  • Mutaciones de cambio de marco: mutaciones que afectan el marco de lectura del gen, lo que resulta en una gran cantidad de aminoácidos alterados.
    • Mutaciones de inserción: se agregan uno o más nucleótidos adicionales en la secuencia
  • Mutaciones por deleción: se eliminan uno o más nucleótidos de la secuencia.

Las mutaciones por sustitución suelen limitarse a cambiar sólo un aminoácido (con excepción de las mutaciones sin sentido); es por eso que también se les llama mutaciones puntuales (afectan sólo a un “punto” o ubicación en la secuencia del gen). Por el contrario, las mutaciones por cambio de marco afectan amplias zonas del gen y la proteína resultante. Por lo general, las mutaciones por desplazamiento del marco de lectura tienen efectos más significativos que las mutaciones por sustitución de bases.

Los tipos de mutaciones por sustitución se resumen en la siguiente figura. Los tipos y efectos de las mutaciones por desplazamiento de marco se analizarán con más detalle a lo largo de esta lección.

Un gen simulado contiene seis aminoácidos y un codón de parada. Las mutaciones silenciosas cambian GUA a GUU, pero ambas codifican a Val. Una mutación sin sentido cambia CCG a UCG, por lo que Pro cambia a Ser. Una mutación sin sentido cambia UAC a UAA, por lo que Tyr cambia a un codón de parada y la proteína termina prematuramente.

¿Qué es una mutación por desplazamiento de marco?

Comprender las mutaciones por desplazamiento del marco depende de una comprensión profunda del marco de lectura de un gen . El código genético se basa en codones: conjuntos de tres nucleótidos, cada uno de los cuales codifica un aminoácido específico. Durante la transcripción, la secuencia de ADN del genoma de una persona se utiliza para crear una transcripción de ARN. Este ARN mensajero está formado por una serie de codones que serán traducidos por los ribosomas celulares para construir una secuencia específica de aminoácidos que conforman la estructura primaria de la proteína codificada por ese gen. Cualquier cambio en el ADN (cualquier mutación) cambiará la secuencia del ARN y muy probablemente también cambiará la proteína resultante.

El marco de lectura de un gen es la forma en que los nucleótidos se dividen en grupos de tres; cada secuencia de ARN tiene tres marcos de lectura posibles (cada secuencia de ADN tiene seis, tres para cada cadena). Los tres posibles marcos de lectura de una secuencia de ARN de muestra se muestran en la siguiente figura:

La secuencia de ADN (CGAUGCCGUAUUACGUACCUUAAUCG) se traduce en tres secuencias de aminoácidos diferentes dependiendo de cuál sea el primer codón completo: AUG, UGC o GCC.

A veces es más fácil comprender los marcos de lectura y las mutaciones de desplazamiento de marco comparando la traducción de secuencias genéticas con la lectura de oraciones en inglés. Imagine que la siguiente oración es un “gen”:

LAS DOS MUJERES ATANDHADTEA

Al igual que el código genético, la frase anterior está formada por “codones”: cada conjunto de tres letras tiene un significado específico. En esta metáfora, cada conjunto de tres letras es una palabra que crea una imagen mental. En el código genético, cada conjunto de tres letras sería un codón, que se traduciría en un aminoácido específico. Además, al igual que un gen, la oración tiene tres posibles “marcos de lectura”, de los cuales sólo uno tiene sentido:

LAS MUJERES ENS ATA NDH ADT EA

LAS DOS NSA TAN DHA DTE A

LOS DOS HOMBRES SE SENTARON Y TOMARON TÉ

Las tres oraciones anteriores son idénticas, pero sólo una tiene la agrupación correcta (el marco de lectura correcto ) para ser realmente comprensible.

Las mutaciones por desplazamiento de marco son mutaciones (cambios en la secuencia del ADN) que hacen que la agrupación de nucleótidos (el marco de lectura) se desalinee, haciendo que la secuencia del gen sea incomprensible. Hay dos tipos de mutaciones de cambio de marco: inserciones (la adición de nucleótidos adicionales) y deleciones (la eliminación de uno o más nucleótidos).

La misma analogía anterior también puede mostrar que las mutaciones por cambio de marco pueden cambiar el marco de lectura de un gen:

Secuencia original del “gen”: LOS DOS HOMBRES SE SENTARON Y TOMARON TÉ

Mutación de desplazamiento del marco de inserción: THE TW Z OME NSA TAN DHA DTE A (Z agregada al segundo “codón”)

Mutación por desplazamiento de marco de eliminación: THE TOM ENS ATA NDH ADT EA (W eliminado del segundo “codón”)

Ejemplos de mutaciones por desplazamiento de marco

IMPORTANTE: En los ejemplos siguientes, solo se muestran los efectos sobre el ARN y la proteína (para simplificar). Sin embargo, recuerda que todas las mutaciones genéticas son el resultado de cambios en el ADN. El ADN se muta (se insertan o eliminan bases), lo que provoca cambios en la secuencia del ARN y el polipéptido resultante.

Las mutaciones de cambio de marco ocurren en dos tipos: mutaciones de inserción y mutaciones de deleción. El efecto general de ambos es similar: el marco de lectura traduccional se “desplaza” fuera de alineación, lo que da como resultado una secuencia de aminoácidos aleatoria.

Las mutaciones por cambio de marco de inserción implican la adición de uno o más nucleótidos adicionales en un lugar aleatorio de la secuencia del gen. La siguiente imagen muestra los efectos de las inserciones de un solo nucleótido y de las inserciones de doble nucleótido en una secuencia genética simulada:

La secuencia del gen (CGAUGCCGUAUUACGUACCUUAAUCG) se traduce como Met-Pro-Tyr-Tyr-Val-Pro. Una sola G insertada después de 6 nucleótidos cambia la proteína a Met-Arg-Val-Leu-Arg-Thr-Leu. La inserción de AG después del sexto nucleótido cambia la proteína a Met-Gln-Arg-Ile-Thr-Tyr-Leu

En ambos casos, el codón donde se produce la inserción se ve afectado, al igual que todos los codones posteriores. Toda la secuencia de aminoácidos después (después) del evento de inserción se ve afectada.

Las mutaciones por cambio de marco de deleción son el resultado de eliminar uno o más nucleótidos en una ubicación aleatoria en la secuencia del gen. La siguiente imagen resalta los efectos de las eliminaciones de un solo nucleótido y de las eliminaciones de doble nucleótido.

La secuencia de ADN inicial (CGAUGCCGUAUUACGUACCUUAAUCG) se traduce como Met-Pro-Tyr-Tyr-Val-Pro. La eliminación de la tercera G cambia la proteína a Met-Pro-Ile-Thr-Tyr-Leu-Asn. La eliminación de GU (los nucleótidos octavo y noveno) da como resultado Met-Pro-Leu-Arg-Thr-Leu-Ile

Las mutaciones por deleción tienen el mismo efecto que las mutaciones de inserción: todos los codones aguas abajo del sitio de deleción se ven afectados y se cambia toda la secuencia de aminoácidos.

Efectos de la mutación por cambio de marco

Las mutaciones de cambio de marco suelen ser algunos de los tipos de mutaciones genéticas más dañinas. A diferencia de las mutaciones por sustitución o puntuales, que sólo afectan a un aminoácido de la cadena proteica, las mutaciones por cambio de marco afectan a todos los aminoácidos situados aguas abajo de su ubicación. El resultado más común de ambos tipos de mutaciones de cambio de marco (tanto inserciones como deleciones) es la pérdida completa de la función del producto genético. Sin embargo, es posible un amplio espectro de resultados posibles, desde un impacto insignificante hasta una pérdida completa de la función e incluso una ganancia de función.

Existen algunas pautas que ayudan a predecir la gravedad del efecto de la mutación:

  • Las mutaciones de cambio de marco cerca del comienzo de un gen tendrán efectos más fuertes que aquellas cerca del final del gen. Cuanto antes se produzca el cambio de marco, mayor será la porción del polipéptido afectada. En el siguiente ejemplo, la proteína tiene 35 aminoácidos de longitud. Una mutación temprana cambia el 90% de los aminoácidos en la secuencia, mientras que una mutación tardía afecta sólo aproximadamente el 20%.
En una proteína de 35 aminoácidos de longitud, un cambio de marco en el cuarto aminoácido cambia los siguientes 32 aminoácidos. Por el contrario, un cambio de marco en el aminoácido 28 sólo afecta a 8 aminoácidos.
  • Las inserciones y/o eliminaciones de uno o dos nucleótidos normalmente tendrán un efecto mucho más grave que agregar o eliminar tres (o múltiplos de tres) nucleótidos. Insertar o eliminar uno o dos nucleótidos desplaza todos los codones posteriores en el marco de lectura, pero insertar o eliminar tres nucleótidos es como agregar o eliminar un codón completo: el marco de lectura posterior no se modifica. Sin embargo, hay casos en los que insertar o eliminar tres nucleótidos aún produce un efecto grave (por ejemplo, consulte la fibrosis quística a continuación).
La secuencia genética inicial es CGAUGCCGUAUUACGUACCUUAAUCG, que da Met-Pro-Tyr-Tyr-Val-Pro-Stop como proteína. La inserción de GAG ​​después de la segunda C cambia la proteína a Met-Arg-Ala-Tyr-Tyr-Val-Pro-Stop (los últimos 5 codones no se ven afectados). La eliminación de GUA (los codones octavo, noveno y décimo) cambia la proteína a Met-Pro-Tyr-Val-Pro-Stop (solo se elimina un codón de prueba)
  • Las inserciones y eliminaciones pueden anularse entre sí si ocurren muy cerca. Si se agrega y luego se elimina la misma cantidad de nucleótidos, solo se cambiará el marco de lectura entre los dos eventos; todos los codones después de la segunda mutación estarán en el marco de lectura normal (y por lo tanto no se verán afectados).
La secuencia genética inicial es CGAUGCCGUAUUACGUACCUUAAUCG, que se traduce como Met-Pro-Tyr-Tyr-Val-Pro-Stop. Insertar una U después del sexto nucleótido y eliminar la segunda A solo cambia la secuencia de la proteína a Met-Leu-Val-Tyr-Val-Pro-Stop

Enfermedades causadas por mutaciones de cambio de marco

Varias enfermedades genéticas humanas se han relacionado con mutaciones de inserción y deleción. La siguiente tabla resume sólo algunas de estas enfermedades.

EnfermedadGeneDescripción de la mutaciónEfecto
Enfermedad de Tay-SachsSubunidad alfa de la beta-hexosaminidasa (Hex-A)Deleción de un solo nucleótido (C)Los lípidos se acumulan en el cerebro y provocan una muerte prematura.
Fibrosis quísticaRegulador de la conductancia transmembrana de la fibrosis quística (CFTR)Deleción de tres nucleótidos o inserción de dos nucleótidosEl transporte inhibido daña los pulmones, el sistema digestivo y otros órganos.
Enfermedad de CrohnDominio de oligomerización de unión a nucleótidos que contiene 2 (NOD2)Inserción de un solo nucleótido (C)Inflamación del tracto digestivo, que causa dolor intenso y diarrea.
Polineuropatía hereditaria (enfermedad de Charcot-Marie-Tooth)Repetición rica en leucina y motivo alfa estéril que contiene 1 (LRSAM1)Inserción de dos nucleótidosDesarrollo anormal de los nervios periféricos en brazos, piernas, manos y pies.
Miocardiopatía hipertróficaTroponina C (TNNC1)Inserción de un solo nucleótido (G)Músculos cardíacos engrosados, a menudo no diagnosticados, pero que pueden causar ritmos cardíacos anormales y muerte súbita.
VIHReceptor 5 de quimiocina CC, un cofactor de entrada celular (CCR5)deleción de 32 nucleótidosLos individuos con esta mutación genética son resistentes a la infección por VIH

Resumen de la lección

Las mutaciones son cualquier cambio hereditario en una secuencia de ADN, que a su vez provoca cambios en las secuencias de ARN y proteínas. Los tipos de mutaciones son:

  • Sustituciones de nucleótidos: un nucleótido se cambia por otro, por ejemplo, “A” se cambia por “G”; También conocidas como mutaciones puntuales.
    • Mutaciones silenciosas: sin efecto sobre la secuencia de aminoácidos
    • Mutaciones sin sentido: un aminoácido se cambia por otro.
    • Mutaciones sin sentido: se cambia un aminoácido por un codón de parada; la proteína termina prematuramente
  • Mutaciones de cambio de marco: mutaciones que afectan el marco de lectura del gen, lo que resulta en una gran cantidad de aminoácidos alterados.
    • Mutaciones de inserción: se agregan uno o más nucleótidos adicionales en la secuencia
    • Mutaciones por deleción: se eliminan uno o más nucleótidos de la secuencia.

Las mutaciones por cambio de marco afectan el marco de lectura de un gen (la forma en que los nucleótidos se agrupan en codones de tres nucleótidos). La inserción o eliminación de nucleótidos altera la agrupación posterior y cambia el marco de lectura, lo que da como resultado una secuencia de proteínas alterada.

Las mutaciones de inserción implican la adición aleatoria de uno o más nucleótidos en la secuencia de ADN, mientras que las mutaciones de eliminación se producen al eliminar uno o más nucleótidos aleatorios.

Las mutaciones de cambio de marco suelen ser muy dañinas ; el afecto más común es una pérdida completa de la función del gen afectado. Sin embargo, los efectos pueden variar dependiendo de

  • ubicación (cuanto antes se produzca la mutación en la secuencia del gen, más grave será el efecto).
  • número de nucleótidos (las inserciones o eliminaciones de múltiplos de tres nucleótidos suelen tener el menor efecto)
  • combinaciones (las inserciones y eliminaciones de igual tamaño pueden cancelarse entre sí si ocurren muy cerca)

Ejemplos de enfermedades genéticas que pueden ser causadas por mutaciones de cambio de marco incluyen la enfermedad de Tay-Sachs, la fibrosis quística, la enfermedad de Crohn, la enfermedad de Charcot-Marie-Tooth (polineuropatía hereditaria) y la miocardiopatía hipertrófica. Una mutación específica en el gen CCR5 también se ha relacionado con la resistencia al VIH.

Articulos relacionados